Stem-loop sequence mdo-let-7b

AccessionMI0005351 (change log)
DescriptionMonodelphis domestica let-7b stem-loop
Gene family MIPF0000002; let-7
Stem-loop
   gg     u                     ucaggguagugauuu 
5'   cgggg gagguaguagguugugugguu               u
     ||||| |||||||||||||||||||||                
3'   guccc uuccgucauccaacauaucaa               g
   -a     -                     uagaagacuaacccc 
Get sequence
Deep sequencing
5681187 reads, 9.53e+04 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr8: 11048200-11048287 [-]
intergenic
Clustered miRNAs
< 10kb from mdo-let-7b
mdo-let-7a-3chr8: 11049697-11049775 [-]
mdo-let-7bchr8: 11048200-11048287 [-]
Database links

Mature sequence mdo-let-7b

Accession MIMAT0004162
Sequence

8 - 

ugagguaguagguugugugguu

 - 29

Get sequence
Deep sequencing5680734 reads, 5 experiments
Evidence experimental; Microarray [1], PCR [1]
Database links
Predicted targets

References

1