Stem-loop sequence mdo-let-7a-1

AccessionMI0005360 (change log)
DescriptionMonodelphis domestica let-7a-1 stem-loop
Gene family MIPF0000002; let-7
Stem-loop
   ucucca  g     u   gu                uuagggucacac 
5'       cu uggga gag  aguagguuguauaguu            c
         || ||||| |||  ||||||||||||||||            c
3'       ga auucu uuc  ucaucuaacauaucaa            a
   ------  a     -   ug                uagagggucacc 
Get sequence
Deep sequencing
7723408 reads, 1.26e+05 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr6: 256413193-256413284 [-]
intergenic
Clustered miRNAs
< 10kb from mdo-let-7a-1
mdo-let-7a-1chr6: 256413193-256413284 [-]
mdo-let-7f-1chr6: 256412444-256412530 [-]
mdo-let-7dchr6: 256407623-256407728 [-]
Database links

Mature sequence mdo-let-7a-5p

Accession MIMAT0004141
Sequence

15 - 

ugagguaguagguuguauaguu

 - 36

Get sequence
Deep sequencing23084043 reads, 5 experiments
Evidence experimental; Microarray [1], PCR [1]
Database links
Predicted targets

References

1