Stem-loop sequence mdo-let-7f-1

AccessionMI0005361 (change log)
DescriptionMonodelphis domestica let-7f-1 stem-loop
Gene family MIPF0000002; let-7
Stem-loop
       a ug                      ---------       u 
5' ucag g  agguaguagauuguauaguugu         gggguag g
   |||| |  ||||||||||||||||||||||         ||||||| a
3' aguc c  uccguuaucuaacauaucaaua         ucccauu u
       - cu                      gaggacuug       u 
Get sequence
Deep sequencing
5562080 reads, 8.96e+04 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr6: 256412444-256412530 [-]
intergenic
Clustered miRNAs
< 10kb from mdo-let-7f-1
mdo-let-7a-1chr6: 256413193-256413284 [-]
mdo-let-7f-1chr6: 256412444-256412530 [-]
mdo-let-7dchr6: 256407623-256407728 [-]
Database links

Mature sequence mdo-let-7f-5p

Accession MIMAT0004161
Sequence

7 - 

ugagguaguagauuguauaguu

 - 28

Get sequence
Deep sequencing11175383 reads, 5 experiments
Evidence experimental; PCR [1], Illumina [2]
Database links
Predicted targets

Mature sequence mdo-let-7f-1-3p

Accession MIMAT0026702
Sequence

63 - 

cuauacaaucuauugccuuccc

 - 84

Get sequence
Deep sequencing144 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).