Stem-loop sequence mdo-let-7d

AccessionMI0005362 (change log)
DescriptionMonodelphis domestica let-7d stem-loop
Gene family MIPF0000002; let-7
Stem-loop
   ----aau    u       a              c      -------uua      g 
5'        gggc ccuagga gagguaguagguug auaguu          gggcag g
          |||| ||||||| |||||||||||||| ||||||          |||||| a
3'        cucg ggauucu uuccgucguccaac uaucaa          cccguu u
   uuauuau    -       -              a      uugaggaaca      u 
Get sequence
Deep sequencing
122986 reads, 1.66e+03 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr6: 256407623-256407728 [-]
intergenic
Clustered miRNAs
< 10kb from mdo-let-7d
mdo-let-7a-1chr6: 256413193-256413284 [-]
mdo-let-7f-1chr6: 256412444-256412530 [-]
mdo-let-7dchr6: 256407623-256407728 [-]
Database links

Mature sequence mdo-let-7d

Accession MIMAT0004172
Sequence

16 - 

agagguaguagguugcauagu

 - 36

Get sequence
Deep sequencing121786 reads, 5 experiments
Evidence experimental; PCR [1]
Database links
Predicted targets

References

1