Stem-loop sequence mtr-MIR169c

AccessionMI0005577 (change log)
DescriptionMedicago truncatula miR169c stem-loop
Gene family MIPF0000037; MIR169_2
Literature search

12 open access papers mention mtr-MIR169c
(49 sentences)

Stem-loop
   g    c         ug           g  --  --a     a 
5'  aaug agccaaggg  auuugccggca au  au   uauga u
    |||| |||||||||  ||||||||||| ||  ||   |||||  
3'  uuac ucgguucuc  ugaacggcugu ua  ua   auacu a
   -    a         cu           g  cg  gag     u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr2: 13450873-13450957 [+]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR169c
mtr-MIR5281dchr2: 13445238-13445410 [-]
mtr-MIR169cchr2: 13450873-13450957 [+]
mtr-MIR169jchr2: 13454079-13454208 [+]
Database links

Mature sequence mtr-miR169c

Accession MIMAT0011063
Sequence

6 - 

cagccaagggugauuugccgg

 - 26

Get sequence
Evidence experimental; 454 [1]

References

1
" Bonnet E Unpublished (2007).
2
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).