Stem-loop sequence mtr-MIR169d

AccessionMI0005578 (change log)
DescriptionMedicago truncatula miR169d stem-loop
Gene family MIPF0000037; MIR169_2
Literature search

12 open access papers mention mtr-MIR169d
(50 sentences)

Stem-loop
   agaugaagccaaggaugacuugccgguauaauaguaauuugccacaaaucuagauagcuauua  u          g            aa  a        --c g             u   -u   uua 
5'                                                                gc auguuuggau ggcggugagauu  ca aauuacag   a cauugugauuuug uga  gcu   a
                                                                  || |||||||||| ||||||||||||  || ||||||||   | ||||||||||||| |||  |||   a
3'                                                                cg uauaaaucua cugccacucuaa  gu uuaauguc   u gugacauuaaaac auu  uga   g
   -----------------------uuauaucggcuuccuacuggacggccuuuacuuugauuua  -          a            ga  a        acu g             u   uu   ugu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr2: 13468364-13468603 [+]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR169d
mtr-MIR169dchr2: 13468364-13468603 [+]
mtr-MIR169echr2: 13473516-13473616 [+]
Database links

Mature sequence mtr-miR169d-5p

Accession MIMAT0011064
Previous IDsmtr-miR169d
Sequence

6 - 

aagccaaggaugacuugccgg

 - 26

Get sequence
Evidence experimental; 454 [1]

Mature sequence mtr-miR169d-3p

Accession MIMAT0022933
Sequence

217 - 

ggcaggucauccuucggcuaua

 - 238

Get sequence
Evidence experimental; Illumina [2]

References

1
" Bonnet E Unpublished (2007).
2
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).
3
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).