Stem-loop sequence mtr-MIR169e

AccessionMI0005579 (change log)
DescriptionMedicago truncatula miR169e stem-loop
Gene family MIPF0000037; MIR169_2
Literature search

12 open access papers mention mtr-MIR169e
(49 sentences)

Stem-loop
   ga    g    -                -ua    aguuuguc         a 
5'   aaug agcc aaggaugacuugccgg   uauu        gcuaaagcu a
     |||| |||| ||||||||||||||||   ||||        |||||||||  
3'   uuau ucgg uuccuacuggacggcc   augg        ugauuucga c
   --    a    c                cuc    ---guugu         u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr2: 13473516-13473616 [+]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR169e
mtr-MIR169dchr2: 13468364-13468603 [+]
mtr-MIR169echr2: 13473516-13473616 [+]
Database links

Mature sequence mtr-miR169e-5p

Accession MIMAT0011065
Previous IDsmtr-miR169e
Sequence

7 - 

gagccaaggaugacuugccgg

 - 27

Get sequence
Evidence by similarity; MI0007212

Mature sequence mtr-miR169e-3p

Accession MIMAT0022934
Sequence

78 - 

ggcaggucauccuucggcuaua

 - 99

Get sequence
Evidence experimental; Illumina [1]

References

1
" Bonnet E Unpublished (2007).
2
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).
3
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).