Stem-loop sequence smo-MIR166b

Accession

MI0006054

Description

Selaginella moellendorffii miR166b stem-loop

Gene family

MIPF0000004; MIR166

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-166_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

The plant mir-166 microRNA precursor is a small non-coding RNA gene. This microRNA (miRNA) has now been predicted or experimentally confirmed in a wide range of plant species. microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 3' arm of the precursor, and both Arabidopsis thaliana and rice genomes contain a number of related miRNA precursors which give rise to almost identical mature sequences. The mature products are thought to have regulatory roles through complementarity to messenger RNA.

Stem-loop

uuccuc      a    g a  u        u     a cu     gauugauuugauacuaaggcuacg 
      agugag acca g ug ggggagug agccu g  cgaga                        c
      |||||| |||| | || |||||||| ||||| |  |||||                         
      ucacuc uggu u ac ccccuuac ucgga c  gcucu                        a
------      g    g g  u        u     c ag     guuucgacacuaguguuggaacac 

Mature sequence smo-miR166b

• Accession: MIMAT0005221
• Sequence: 99 - ucggaccaggcuucauucccc - 119
• Evidence: experimental; 454 [1]

References

1. PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).