Stem-loop sequence cre-MIR1171

AccessionMI0006231 (change log)
DescriptionChlamydomonas reinhardtii miR1171 stem-loop
Stem-loop
             u   g   a u  a    a u    u   ----  u        g  caa      g  u     ggu c      c c -cuu    uga 
5' gggaguggag gga ugg g gg gugg g ggag ggg    ag gggagugg ug   gggcgu gg gggug   g ggcggg g g    gucg   c
   |||||||||| ||| ||| | || |||| | |||| |||    || |||||||| ||   |||||| || |||||   | |||||| | |    ||||    
3' cccucgccuc ccu gcc c cc cacc c cuuc ccc    uc cccucauc gc   uccgca cc uccgc   c ccgccc c c    cagu   a
             -   -   - -  g    - -    c   aacg  c        -  ---      a  -     aac u      - a uacu    ucc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHLRE3.1) Overlapping transcripts
scaffold_51: 419396-419582 [-]
intergenic
Database links

Mature sequence cre-miR1171

Accession MIMAT0005430
Sequence

16 - 

uggaguggaguggaguggagugg

 - 38

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:17538623 "miRNAs control gene expression in the single-cell alga Chlamydomonas reinhardtii" Molnar A, Schwach F, Studholme DJ, Thuenemann EC, Baulcombe DC Nature. 447:1126-1129(2007).