Stem-loop sequence mcmv-mir-M23-2

AccessionMI0006253 (change log)
DescriptionMouse cytomegalovirus miR-M23-2 stem-loop
Gene family MIPF0000453; mir-m21-1
Stem-loop
        g     a  u u         -   ---    u 
5' ccccg cuuga cg g ccccuaucg gug   guag u
   ||||| ||||| || | ||||||||| |||   ||||  
3' ggggc gaacu gc c ggggguagc cgu   cguc u
        -     g  u c         a   gug    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mcmv-miR-M23-2-5p

Accession MIMAT0005544
Previous IDsmcmv-miR-M23-2*
Sequence

9 - 

ugaacguguccccuaucggugg

 - 30

Get sequence
Evidence experimental; cloned [1-2]

Mature sequence mcmv-miR-M23-2-3p

Accession MIMAT0005545
Previous IDsmcmv-miR-M23-2
Sequence

51 - 

augggggccucggucaagcgg

 - 71

Get sequence
Evidence experimental; cloned [1-2]

References

1
2
PMID:17942535 "Mouse cytomegalovirus microRNAs dominate the cellular small RNA profile during lytic infection and show features of posttranscriptional regulation" Dolken L, Perot J, Cognat V, Alioua A, John M, Soutschek J, Ruzsics Z, Koszinowski U, Voinnet O, Pfeffer S J Virol. 81:13771-13782(2007).