Stem-loop sequence mcmv-mir-m88-1

AccessionMI0006259 (change log)
DescriptionMouse cytomegalovirus miR-m88-1 stem-loop
Stem-loop
           cc           ------      cg    
5' augaccga  cccugacaucg      gcggcg  aga 
   ||||||||  |||||||||||      ||||||  || u
3' ugcuggcu  ggggcuguagc      cgccgu  uuu 
           cu           ugaaga      au    
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mcmv-miR-m88-1-5p

Accession MIMAT0005551
Previous IDsmcmv-miR-m88-1*
Sequence

1 - 

augaccgacccccugacaucgg

 - 22

Get sequence
Evidence experimental; cloned [2]

Mature sequence mcmv-miR-m88-1-3p

Accession MIMAT0005552
Previous IDsmcmv-miR-m88-1
Sequence

44 - 

cagaagucgaugucggggucu

 - 64

Get sequence
Evidence experimental; cloned [1-2]

References

1
2
PMID:17942535 "Mouse cytomegalovirus microRNAs dominate the cellular small RNA profile during lytic infection and show features of posttranscriptional regulation" Dolken L, Perot J, Cognat V, Alioua A, John M, Soutschek J, Ruzsics Z, Koszinowski U, Voinnet O, Pfeffer S J Virol. 81:13771-13782(2007).