Stem-loop sequence mcmv-mir-m107-1

AccessionMI0006261 (change log)
DescriptionMouse cytomegalovirus miR-m107-1 stem-loop
Gene family MIPF0000446; mir-m107-1
Stem-loop
      c          u u    u     ucc  a 
5' cga cggucacucg c cgag caccg   gu g
   ||| |||||||||| | |||| |||||   ||  
3' gcu gccagugagc g gcuc guggc   ca c
      c          u c    -     --u  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mcmv-miR-m107-1-5p

Accession MIMAT0005555
Sequence

5 - 

cggucacucgucucgagucacc

 - 26

Get sequence
Evidence experimental; cloned [2]

Mature sequence mcmv-miR-m107-1-3p

Accession MIMAT0005556
Sequence

43 - 

ugcucgcgucgagugaccgcuc

 - 64

Get sequence
Evidence experimental; cloned [1]

References

1
2
PMID:17942535 "Mouse cytomegalovirus microRNAs dominate the cellular small RNA profile during lytic infection and show features of posttranscriptional regulation" Dolken L, Perot J, Cognat V, Alioua A, John M, Soutschek J, Ruzsics Z, Koszinowski U, Voinnet O, Pfeffer S J Virol. 81:13771-13782(2007).