Stem-loop sequence vvi-MIR160b

AccessionMI0006497 (change log)
DescriptionVitis vinifera miR160b stem-loop
Gene family MIPF0000032; MIR160
Literature search

4 open access papers mention vvi-MIR160b
(10 sentences)

Stem-loop
   ---aaua    u    c         ga      uc  a    c       ag 
5'        uugu cugc uggcucccu  augcca  ua gaag uuguuaa  a
          |||| |||| |||||||||  ||||||  || |||| |||||||   
3'        agcg gacg acugagggg  uacggu  au cuuc aacaguu  g
   uucacaa    -    a         ag      uu  c    c       gu 
Get sequence
Deep sequencing
166 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr10: 1222379-1222482 [+]
intergenic
Database links

Mature sequence vvi-miR160b

Accession MIMAT0005652
Sequence

11 - 

ugccuggcucccugaaugccauc

 - 33

Get sequence
Deep sequencing136 reads, 2 experiments
Evidence experimental; Array [2], Illumina [2]

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).
2
PMID:19939267 "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera" Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS BMC Genomics. 10:558(2009).