Stem-loop sequence vvi-MIR160c

AccessionMI0006498 (change log)
DescriptionVitis vinifera miR160c stem-loop
Gene family MIPF0000032; MIR160
Literature search

4 open access papers mention vvi-MIR160c
(12 sentences)

Stem-loop
   ---aaa     u    c       c          a      -ga   c   cu 
5'       ugggu gugc uggcucc uguaugccac cguaga   cca ucc  u
         ||||| |||| ||||||| |||||||||| ||||||   ||| |||  u
3'       accca uacg accgagg gcgugcggug gcguuu   ggu agg  c
   cuuacc     -    a       a          g      auc   u   cc 
Get sequence
Deep sequencing
179 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr10: 11745661-11745766 [+]
intergenic
Database links

Mature sequence vvi-miR160c

Accession MIMAT0005653
Sequence

11 - 

ugccuggcucccuguaugcca

 - 31

Get sequence
Deep sequencing142 reads, 2 experiments
Evidence experimental; Array [2], Illumina [2]

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).
2
PMID:19939267 "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera" Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS BMC Genomics. 10:558(2009).