Stem-loop sequence vvi-MIR160d

AccessionMI0006499 (change log)
DescriptionVitis vinifera miR160d stem-loop
Gene family MIPF0000032; MIR160
Literature search

3 open access papers mention vvi-MIR160d
(8 sentences)

Stem-loop
   --cauacuua     c       c              a   u c   cga 
5'           caugc uggcucc uguaugccauuugc aag c acc   g
             ||||| ||||||| |||||||||||||| ||| | |||    
3'           guacg accgagg gcgugcgguaggcg uuc g ugg   g
   uucguucuac     u       a              c   c a   uua 
Get sequence
Deep sequencing
188 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr8: 13017021-13017122 [+]
intergenic
Database links

Mature sequence vvi-miR160d

Accession MIMAT0005654
Sequence

11 - 

ugccuggcucccuguaugcca

 - 31

Get sequence
Deep sequencing150 reads, 2 experiments
Evidence experimental; Array [2], Illumina [2]

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).
2
PMID:19939267 "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera" Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS BMC Genomics. 10:558(2009).