Stem-loop sequence vvi-MIR162

AccessionMI0006502 (change log)
DescriptionVitis vinifera miR162 stem-loop
Gene family MIPF0000127; MIR162_1
Literature search

4 open access papers mention vvi-MIR162
(26 sentences)

Stem-loop
   ----    gu a          c    c       uc   c   aa     gug 
5'     ugaa  c cuggaugcag gguu aucgauc  uuc uga  uuguu   a
       ||||  | |||||||||| |||| |||||||  ||| |||  |||||    
3'     acuu  g gaccuacguc ccaa uagcugg  aag acu  gacga   a
   ccuc    -- c          u    a       cu   a   -a     aaa 
Get sequence
Deep sequencing
8211 reads, 550 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr17: 4716519-4716621 [+]
intergenic
Database links

Mature sequence vvi-miR162

Accession MIMAT0005657
Sequence

73 - 

ucgauaaaccucugcauccag

 - 93

Get sequence
Deep sequencing8159 reads, 2 experiments
Evidence experimental; Array [2], Illumina [2]

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).
2
PMID:19939267 "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera" Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS BMC Genomics. 10:558(2009).