Stem-loop vvi-MIR166c

Accession

MI0006509

Description

Vitis vinifera vvi-MIR166c precursor miRNA

Gene family

MIPF0000004; MIR166

Literature search

8 open access papers mention vvi-MIR166c
(17 sentences)

Sequence

2199909 reads, 147510 reads per million, 2 experiments

cuauuuugaggggaauguugucuggcucgaggacacuuaccuuaacuuugauccguuucucuagauccauaucaccuauauauauguauuauuguauuuuuauuuguacugagcauguguuggugucgUCGGACCAGGCUUCAUUCCCCccaauuaucgc
.....(((.((((((((..((((((.((((.((((((............((((..........))))............((((((((.(((..((((........))))))))))))))).)))))).)))).))))))..)))))))).))).......

Structure

--cuauu   a        uu      c    g      uaccuuaacuuugauccguuucucuagauccauaucaccuau        a   uu    uuu 
       uug ggggaaug  gucugg ucga gacacu                                          auauaugu uua  guau   u
       ||| ||||||||  |||||| |||| ||||||                                          |||||||| |||  ||||    
       aac CCCCUUAC  CGGACC GGCU cugugg                                          uguguacg agu  caug   a
cgcuauu   c        UU      A    g      -----------------------------------------u        -   --    uuu 

Annotation confidence Not enough data

Genome context

chr15: 16978572-16978731 [-]

Mature vvi-miR166c

• Accession: MIMAT0005664
• Description: Vitis vinifera vvi-miR166c mature miRNA
• Sequence: 129 - UCGGACCAGGCUUCAUUCCCC - 149
• Evidence: experimental ; Array [2], Illumina [2]

References

1. PubMed ID: 17721507
   The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla
   "Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro"
   "Nature (2007) 449:463-467


2. PubMed ID: 19939267
   High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera
   Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pè ME, Horner DS
   BMC Genomics (2009) 10:558