Stem-loop sequence vvi-MIR167d

AccessionMI0006518 (change log)
DescriptionVitis vinifera miR167d stem-loop
Gene family MIPF0000023; MIR167_1
Literature search

7 open access papers mention vvi-MIR167d
(12 sentences)

Stem-loop
   --      ua     a    c  --             ----      agg   acagaga 
5'   agggaa  aguga gcug ca  gcaugaucuagcu    uuggcu   gau       a
     ||||||  ||||| |||| ||  |||||||||||||    ||||||   |||        
3'   uuccuu  ucacu cgac gu  cguacuggaucga    aaucga   cua       a
   uc      cc     c    a  cc             uccc      -ga   gagagag 
Get sequence
Deep sequencing
984536 reads, 6.54e+04 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
NW_003724203.1: 254821-254935 [+]
intergenic
Clustered miRNAs
< 10kb from vvi-MIR167d
vvi-MIR167dNW_003724203.1: 254821-254935 [+]
vvi-MIR167cNW_003724203.1: 260014-260104 [+]
Database links

Mature sequence vvi-miR167d

Accession MIMAT0005673
Sequence

11 - 

ugaagcugccagcaugaucua

 - 31

Get sequence
Deep sequencing984532 reads, 2 experiments
Evidence experimental; Array [2], Illumina [2]

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).
2
PMID:19939267 "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera" Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS BMC Genomics. 10:558(2009).