Stem-loop sequence oan-let-7e

AccessionMI0006773 (change log)
DescriptionOrnithorhynchus anatinus let-7e stem-loop
Gene family MIPF0000002; let-7
Stem-loop
   ggcucccaccacaguc     -   g   cu   gu         a      -  -------     c 
5'                 cuguc cuu agg  gag  aguagauug auaguu gu       ggggu a
                   ||||| ||| |||  |||  ||||||||| |||||| ||       |||||  
3'                 gacag gga ucc  uuc  ucaucuaac uaucaa cg       cuccg c
   ------ccgcuugacu     c   g   -u   ug         a      u  ugugucc     g 
Get sequence
Deep sequencing
6454019 reads, 1.09e+05 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Contig239044: 265-386 [+]
intergenic
Database links

Mature sequence oan-let-7e-5p

Accession MIMAT0006984
Previous IDsoan-let-7e
Sequence

30 - 

ugagguaguagauugaauaguu

 - 51

Get sequence
Deep sequencing6453359 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links

Mature sequence oan-let-7e-3p

Accession MIMAT0006985
Previous IDsoan-let-7e*
Sequence

80 - 

cuauacaaucuacugucuuucc

 - 101

Get sequence
Deep sequencing658 reads, 5 experiments
Evidence experimental; Illumina [1]

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).