Stem-loop sequence oan-mir-98

AccessionMI0006894 (change log)
DescriptionOrnithorhynchus anatinus miR-98 stem-loop
Gene family MIPF0000002; let-7
Stem-loop
      --uaa    ----      ----ug  -         au                 u    --------          a 
5' ucg     gcug    ucagug      cc caugcuggg  gagguaguaaguuguau guug        ugggguaggg u
   |||     ||||    ||||||      || |||||||||  ||||||||||||||||| ||||        |||||||||| u
3' agc     ugau    ggucac      gg gugugaccc  uuucaucauuuaacaua caau        accccguuuu u
      caaug    ccug      uagcaa  u         -c                 u    agcgauua          c 
Get sequence
Deep sequencing
5647041 reads, 9.44e+04 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Ultra403: 71661-71809 [-]
sense
ENSOANT00000001129 ; HUWE1-202; intron 57
ENSOANT00000001130 ; HUWE1-201; intron 63
Clustered miRNAs
< 10kb from oan-mir-98
oan-let-7f-2Ultra403: 72417-72546 [-]
oan-mir-98Ultra403: 71661-71809 [-]
Database links

Mature sequence oan-miR-98

Accession MIMAT0007178
Sequence

31 - 

ugagguaguaaguuguauuguu

 - 52

Get sequence
Deep sequencing5647000 reads, 5 experiments
Evidence experimental; Illumina [1]

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).