![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence gga-mir-1416 |
|||||
Accession | MI0006981 (change log) | ||||
Description | Gallus gallus miR-1416 stem-loop | ||||
Gene family | MIPF0000692; mir-1426 | ||||
Literature search |
![]()
4 open access papers mention gga-mir-1416 | ||||
Stem-loop |
u a uuc cgc ccuu u 5' g ggcugauacuuu cuuaacucaugc ugug ua a | |||||||||||| |||||||||||| |||| || u 3' c cugacuaugaga gaguugaguaug acac au u a - cau uua -uuu u |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Genome context |
|
||||
Database links |
Mature sequence gga-miR-1416-5p |
|
Accession | MIMAT0007285 |
Previous IDs | gga-miR-1416 |
Sequence |
17 - uccuuaacucaugccgcugug - 37 |
Deep sequencing | 6087 reads, 5 experiments |
Evidence | experimental; cloned [1], 454 [3] |
Predicted targets |
|
Mature sequence gga-miR-1416-3p |
|
Accession | MIMAT0007286 |
Previous IDs | gga-miR-1416* |
Sequence |
55 - acaauuguaugaguugaguaca - 76 |
Deep sequencing | 137 reads, 4 experiments |
Evidence | experimental; cloned [1], Illumina [2] |
Predicted targets |
|
References |
|
1 |
PMID:18463306
"Conservation of small RNA pathways in platypus"
Genome Res. 18:995-1004(2008).
|
2 |
PMID:18469162
"A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach"
Genome Res. 18:957-964(2008).
|
3 |
PMID:18430245
"Deep sequencing of chicken microRNAs"
BMC Genomics. 9:185(2008).
|