Stem-loop sequence cin-let-7b

AccessionMI0007151 (change log)
DescriptionCiona intestinalis let-7b stem-loop
Gene family MIPF0000002; let-7
Literature search

3 open access papers mention cin-let-7b
(18 sentences)

Stem-loop
   ------------a    c  c  c   u     -  u        u   --------    cau 
5'              ggua ac ug ugu gaggu ag agguuaug ugu        ugca   a
                |||| || || ||| ||||| || |||||||| |||        ||||    
3'              cuau ug ac acg cucca uc uccaguac aca        acgu   a
   gguacaacuuuca    c  u  c   u     a  u        c   uagagguu    cau 
Get sequence
Deep sequencing
14924 reads, 4.6e+03 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI2) Overlapping transcripts
4q: 2082788-2082896 [+]
intergenic
Clustered miRNAs
< 10kb from cin-let-7b
cin-let-7a-14q: 2082260-2082369 [+]
cin-let-7f4q: 2082406-2082478 [+]
cin-let-7b4q: 2082788-2082896 [+]
cin-let-7c4q: 2082979-2083088 [+]
cin-let-7a-24q: 2083177-2083286 [+]
Database links

Mature sequence cin-let-7b-5p

Accession MIMAT0006087
Previous IDscin-let-7b
Sequence

16 - 

ugagguaguagguuauguuguu

 - 37

Get sequence
Deep sequencing14904 reads, 2 experiments
Evidence experimental; Illumina [2]

Mature sequence cin-let-7b-3p

Accession MIMAT0015249
Previous IDscin-let-7b*
Sequence

63 - 

accaugaccuucuaaccucugc

 - 84

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; Illumina [2]

References

1
PMID:18339653 "Altered miRNA repertoire in the simplified chordate, Oikopleura dioica" Fu X, Adamski M, Thompson EM Mol Biol Evol. 25:1067-1080(2008).
2