Stem-loop sequence csa-let-7c-2

AccessionMI0007184 (change log)
DescriptionCiona savignyi let-7c-2 stem-loop
Gene family MIPF0000002; let-7
Literature search

2 open access papers mention csa-let-7c-2
(14 sentences)

Stem-loop
   cuc   c      cau   g                 -------ug     aau 
5'    uug ugauaa   gag uaguagguuaugcaguu         gcgac   a
      ||| ||||||   ||| |||||||||||||||||         |||||    
3'    aac gcuauu   cuc gucguucaaugugucaa         cguug   u
   cuc   a      -uu   g                 uagaggaaa     cuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CSAV2.0) Overlapping transcripts
reftig_41: 1117496-1117597 [+]
intergenic
Clustered miRNAs
< 10kb from csa-let-7c-2
csa-let-7c-1reftig_41: 1114139-1114239 [+]
csa-let-7breftig_41: 1115604-1115705 [+]
csa-let-7areftig_41: 1116068-1116169 [+]
csa-let-7c-2reftig_41: 1117496-1117597 [+]
Database links

Mature sequence csa-let-7c

Accession MIMAT0006118
Sequence

16 - 

ugagguaguagguuaugcaguu

 - 37

Get sequence
Evidence by similarity; MI0007138

References

1
PMID:18339653 "Altered miRNA repertoire in the simplified chordate, Oikopleura dioica" Fu X, Adamski M, Thompson EM Mol Biol Evol. 25:1067-1080(2008).