![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence gma-MIR171a |
|||||
Accession | MI0007213 (change log) | ||||
Description | Glycine max miR171a stem-loop | ||||
Gene family | MIPF0000030; MIR171_1 | ||||
Literature search |
![]()
16 open access papers mention gma-MIR171a | ||||
Stem-loop |
-------- aacgg uc a au a 5' guuc gauauugg cgguucaau agaaagca gcucaaa u |||| |||||||| ||||||||| |||||||| ||||||| g 3' caag cuauaacc gccgaguua uuuuuugu uggguuu u cucgucac ---ca gu c cc u |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence gma-miR171a |
|
Accession | MIMAT0007358 |
Sequence |
72 - ugagccgugccaauaucacga - 92 |
Evidence | experimental; 454 [1-2], SOLiD [3] |
References |
|
1 |
PMID:18402695
"Novel and nodulation-regulated microRNAs in soybean roots"
BMC Genomics. 9:160(2008).
|
2 |
PMID:21504877
"MicroRNAs in the shoot apical meristem of soybean"
J Exp Bot. 62:2495-2506(2011).
|
3 |
PMID:21751852
"Transcriptional analysis of soybean root response to Fusarium virguliforme, the causal agent of sudden death syndrome"
Mol Plant Microbe Interact. 24:958-972(2011).
|