Stem-loop sequence gma-MIR171a

AccessionMI0007213 (change log)
DescriptionGlycine max miR171a stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

16 open access papers mention gma-MIR171a
(39 sentences)

Stem-loop 
   --------    aacgg        uc         a        au       a 
5'         guuc     gauauugg  cgguucaau agaaagca  gcucaaa u
           ||||     ||||||||  ||||||||| ||||||||  ||||||| g
3'         caag     cuauaacc  gccgaguua uuuuuugu  uggguuu u
   cucgucac    ---ca        gu         c        cc       u
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr12: 8478656-8478757 [+]
intergenic
Database links

Mature sequence gma-miR171a

Accession MIMAT0007358
Sequence

72 -  

ugagccgugccaauaucacga

 - 92

Get sequence
Evidence experimental; 454 [1-2], SOLiD [3]

References

1
PMID:18402695 "Novel and nodulation-regulated microRNAs in soybean roots" Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O BMC Genomics. 9:160(2008).
2
PMID:21504877 "MicroRNAs in the shoot apical meristem of soybean" Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL J Exp Bot. 62:2495-2506(2011).
3
PMID:21751852 "Transcriptional analysis of soybean root response to Fusarium virguliforme, the causal agent of sudden death syndrome" Radwan O, Liu Y, Clough SJ Mol Plant Microbe Interact. 24:958-972(2011).