Stem-loop sequence gma-MIR390a

AccessionMI0007214 (change log)
DescriptionGlycine max miR390a stem-loop
Gene family MIPF0000101; MIR390
Literature search

21 open access papers mention gma-MIR390a
(83 sentences)

Stem-loop
   ---------    u    a          g         cau   u    uucucu 
5'          agaa cugu aagcucagga ggauagcgc   gga gauc      u
            |||| |||| |||||||||| |||||||||   ||| ||||       
3'          ucuu ggua uuugaguccu ccuaucgcg   ucu cuag      c
   acacuucua    c    c          a         uuc   u    uucuca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr3: 6398854-6398958 [-]
intergenic
Database links

Mature sequence gma-miR390a-5p

Accession MIMAT0007359
Sequence

11 - 

aagcucaggagggauagcgcc

 - 31

Get sequence
Evidence experimental; 454 [1]

Mature sequence gma-miR390a-3p

Accession MIMAT0007360
Sequence

68 - 

cgcuauccauccugaguuuc

 - 87

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:18402695 "Novel and nodulation-regulated microRNAs in soybean roots" Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O BMC Genomics. 9:160(2008).