Stem-loop sequence gma-MIR390b

AccessionMI0007215 (change log)
DescriptionGlycine max miR390b stem-loop
Gene family MIPF0000101; MIR390
Literature search

20 open access papers mention gma-MIR390b
(78 sentences)

Stem-loop
       u    a          g       a   u a   --ug ug     au 
5' agaa cugu aagcucagga ggauagc ccg g uac    a  auuau  g
   |||| |||| |||||||||| ||||||| ||| | |||    |  |||||   
3' ucuu ggua uucgaguucu ucuaucg ggu c aug    u  ugaua  u
       c    c          a       c   u -   caua gu     cu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr14: 46392430-46392532 [+]
intergenic
Database links

Mature sequence gma-miR390b-5p

Accession MIMAT0007361
Previous IDsgma-miR390b
Sequence

11 - 

aagcucaggagggauagcacc

 - 31

Get sequence
Evidence experimental; 454 [1], Illumina [2]

Mature sequence gma-miR390b-3p

Accession MIMAT0020935
Previous IDsgma-miR390b*
Sequence

68 - 

uacuuggcgcuaucuaucuuga

 - 89

Get sequence
Evidence experimental; SOLiD [3]

References

1
PMID:18402695 "Novel and nodulation-regulated microRNAs in soybean roots" Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O BMC Genomics. 9:160(2008).
2
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).
3