Stem-loop sequence gma-MIR393a

AccessionMI0007216 (change log)
Previous IDsgma-MIR393
DescriptionGlycine max miR393 stem-loop
Gene family MIPF0000083; MIR393
Literature search

22 open access papers mention gma-MIR393a
(55 sentences)

Stem-loop
   g       c            c    u          cc   c  c      cuucucucu 
5'  gaggagg auccaaagggau gcau gaucccaaau  aag uu aauauu         u
    ||||||| |||||||||||| |||| ||||||||||  ||| || ||||||          
3'  uuccucu uagguuucccua cgua cuaggguuua  uuu aa uuauaa         u
   u       u            u    -          --   u  -      aacucaccc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr11: 32101395-32101514 [+]
intergenic
Database links

Mature sequence gma-miR393a

Accession MIMAT0007362
Previous IDsgma-miR393
Sequence

11 - 

uccaaagggaucgcauugauc

 - 31

Get sequence
Evidence experimental; 454 [1], Northern [1]

References

1
PMID:18402695 "Novel and nodulation-regulated microRNAs in soybean roots" Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O BMC Genomics. 9:160(2008).