Stem-loop sequence gma-MIR1507a

AccessionMI0007219 (change log)
Previous IDsgma-MIR1507
DescriptionGlycine max miR1507a stem-loop
Gene family MIPF0000699; MIR1507
Literature search

21 open access papers mention gma-MIR1507a
(54 sentences)

Stem-loop
   -cagu     g    -                  a     -      uuuuc      
5'      guuug caga gguguauggagugagaga gggaa agggua     cgauu 
        ||||| |||| |||||||||||||||||| ||||| ||||||     |||| c
3'      caagc gucu cuacauaccuuacucucu cccuu ucucau     gcugu 
   cuaug     a    g                  -     c      ----u      
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr13: 27036567-27036673 [+]
intergenic
Database links

Mature sequence gma-miR1507a

Accession MIMAT0007365
Previous IDsgma-miR1507
Sequence

76 - 

ucucauuccauacaucgucuga

 - 97

Get sequence
Evidence experimental; 454 [1,3], cloned [2]

References

1
PMID:18402695 "Novel and nodulation-regulated microRNAs in soybean roots" Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O BMC Genomics. 9:160(2008).
2
PMID:19084500 "Identification and expression analysis of miRNAs from nitrogen-fixing soybean nodules" Wang Y, Li P, Cao X, Wang X, Zhang A, Li X Biochem Biophys Res Commun. 378:799-803(2009).
3
PMID:21504877 "MicroRNAs in the shoot apical meristem of soybean" Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL J Exp Bot. 62:2495-2506(2011).