![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence gma-MIR1507a |
|||||
Accession | MI0007219 (change log) | ||||
Previous IDs | gma-MIR1507 | ||||
Description | Glycine max miR1507a stem-loop | ||||
Gene family | MIPF0000699; MIR1507 | ||||
Literature search |
![]()
21 open access papers mention gma-MIR1507a | ||||
Stem-loop |
-cagu g - a - uuuuc 5' guuug caga gguguauggagugagaga gggaa agggua cgauu ||||| |||| |||||||||||||||||| ||||| |||||| |||| c 3' caagc gucu cuacauaccuuacucucu cccuu ucucau gcugu cuaug a g - c ----u |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence gma-miR1507a |
|
Accession | MIMAT0007365 |
Previous IDs | gma-miR1507 |
Sequence |
76 - ucucauuccauacaucgucuga - 97 |
Evidence | experimental; 454 [1,3], cloned [2] |
References |
|
1 |
PMID:18402695
"Novel and nodulation-regulated microRNAs in soybean roots"
BMC Genomics. 9:160(2008).
|
2 |
PMID:19084500
"Identification and expression analysis of miRNAs from nitrogen-fixing soybean nodules"
Biochem Biophys Res Commun. 378:799-803(2009).
|
3 |
PMID:21504877
"MicroRNAs in the shoot apical meristem of soybean"
J Exp Bot. 62:2495-2506(2011).
|