Stem-loop sequence gma-MIR1509a

AccessionMI0007221 (change log)
Previous IDsgma-MIR1509
DescriptionGlycine max miR1509a stem-loop
Gene family MIPF0000771; MIR1509
Literature search

12 open access papers mention gma-MIR1509a
(27 sentences)

Stem-loop
   cu    -cu  -             u        c --u u -u      -aagaa  u 
5'   gcau   uc uuaaucaaggaaa cacggucg g   g g  gccgga      ag g
     ||||   || ||||||||||||| |||||||| |   | |  ||||||      ||  
3'   cgug   ag aauugguuccuuu gugccagc c   c c  uggccu      uc g
   --    uau  c             -        u uuu u uu      cuagug  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr17: 9813056-9813166 [+]
intergenic
Database links

Mature sequence gma-miR1509a

Accession MIMAT0007367
Previous IDsgma-miR1509
Sequence

11 - 

uuaaucaaggaaaucacggucg

 - 32

Get sequence
Evidence experimental; 454 [1,4], cloned [2], Illumina [3]

References

1
PMID:18402695 "Novel and nodulation-regulated microRNAs in soybean roots" Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O BMC Genomics. 9:160(2008).
2
PMID:19084500 "Identification and expression analysis of miRNAs from nitrogen-fixing soybean nodules" Wang Y, Li P, Cao X, Wang X, Zhang A, Li X Biochem Biophys Res Commun. 378:799-803(2009).
3
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).
4
PMID:21504877 "MicroRNAs in the shoot apical meristem of soybean" Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL J Exp Bot. 62:2495-2506(2011).