Stem-loop sequence gma-MIR1513a

AccessionMI0007225 (change log)
Previous IDsgma-MIR1513
DescriptionGlycine max miR1513 stem-loop
Gene family MIPF0001360; MIR1513
Literature search

2 open access papers mention gma-MIR1513a
(6 sentences)

Stem-loop
       c                         c     ca       c 
5' ggau agauaugagagaaagccaugacuua acaca  uugaaau u
   |||| ||||||||||||||||||||||||| |||||  |||||||  
3' ccua ucuauacucucuuuugguacugaau ugugu  aauuuug u
       a                         a     -a       a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr7: 43192197-43192289 [+]
intergenic
Database links

Mature sequence gma-miR1513a-5p

Accession MIMAT0007371
Previous IDsgma-miR1513
Sequence

11 - 

ugagagaaagccaugacuuac

 - 31

Get sequence
Evidence experimental; 454 [1], Northern [1]

Mature sequence gma-miR1513a-3p

Accession MIMAT0020936
Previous IDsgma-miR1513*
Sequence

52 - 

uuuaaauguguauaagucauggu

 - 74

Get sequence
Evidence experimental; SOLiD [2]

References

1
PMID:18402695 "Novel and nodulation-regulated microRNAs in soybean roots" Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O BMC Genomics. 9:160(2008).
2