Stem-loop sequence gma-MIR1514a

AccessionMI0007226 (change log)
DescriptionGlycine max miR1514a stem-loop
Gene family MIPF0000694; MIR1514
Literature search

5 open access papers mention gma-MIR1514a
(12 sentences)

Stem-loop
   cuuugcua          u                 cccuucuuguucc 
5'         uuuucauuuu aaaauaggcauuggggu             u
           |||||||||| |||||||||||||||||              
3'         aaaaguaaaa uuuuauccguaacccua             c
   auagcaac          -                 uccuuuccuuuuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr7: 43120760-43120858 [-]
intergenic
Database links

Mature sequence gma-miR1514a-5p

Accession MIMAT0007372
Previous IDsgma-miR1514a
Sequence

11 - 

uucauuuuuaaaauaggcauu

 - 31

Get sequence
Evidence experimental; 454 [1], Illumina [2]

Mature sequence gma-miR1514a-3p

Accession MIMAT0032031
Sequence

71 - 

augccuauuuuaaaaugaaaa

 - 91

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:18402695 "Novel and nodulation-regulated microRNAs in soybean roots" Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O BMC Genomics. 9:160(2008).
2