Stem-loop sequence gma-MIR1514b

AccessionMI0007227 (change log)
DescriptionGlycine max miR1514b stem-loop
Gene family MIPF0000694; MIR1514
Literature search

5 open access papers mention gma-MIR1514b
(12 sentences)

Stem-loop
   cuuugcua          u       a       -  ucu  uuguuccucuuu 
5'         uuuucauuuu aaaauag cauuggg cu   uc            u
           |||||||||| ||||||| ||||||| ||   ||            u
3'         aaaaguaaaa uuuuauc guaaucc gg   ag            u
   auaguaac          -       c       u  uuu  ccuuaaccuucc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr17: 1491521-1491629 [+]
intergenic
Database links

Mature sequence gma-miR1514b-5p

Accession MIMAT0007373
Previous IDsgma-miR1514b
Sequence

11 - 

uucauuuuuaaaauagacauu

 - 31

Get sequence
Evidence experimental; 454 [1]

Mature sequence gma-miR1514b-3p

Accession MIMAT0032032
Sequence

81 - 

augccuauuuuaaaaugaaaa

 - 101

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:18402695 "Novel and nodulation-regulated microRNAs in soybean roots" Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O BMC Genomics. 9:160(2008).
2