Stem-loop sequence gma-MIR1515a

AccessionMI0007228 (change log)
Previous IDsgma-MIR1515
DescriptionGlycine max miR1515 stem-loop
Gene family MIPF0001591; MIR1515
Literature search

11 open access papers mention gma-MIR1515a
(23 sentences)

Stem-loop
   u    guu              caa     u   c auuuugauucccugcaccguuauuucguuguggcau 
5'  aaau   caucauuuugcgug   ugauc gaa c                                    a
    ||||   ||||||||||||||   ||||| ||| |                                     
3'  uuua   guaguaaaacgcac   acuag cuu g                                    a
   u    acu              -uc     u   u caaaagguguuuguauuuuaguuaccgaauuaaacu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr1: 49411416-49411560 [+]
intergenic
Database links

Mature sequence gma-miR1515a

Accession MIMAT0007374
Previous IDsgma-miR1515
Sequence

11 - 

ucauuuugcgugcaaugaucug

 - 32

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:18402695 "Novel and nodulation-regulated microRNAs in soybean roots" Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O BMC Genomics. 9:160(2008).