Stem-loop sequence gma-MIR1516a

AccessionMI0007229 (change log)
Previous IDsgma-MIR1516
DescriptionGlycine max miR1516 stem-loop
Gene family MIPF0001353; MIR1516
Literature search

2 open access papers mention gma-MIR1516a
(2 sentences)

Stem-loop
   ca                                          a a         
5'   uguuuggauacaaguuauaagcucuuuugagagcuucucuac g aaauauau 
     |||||||||||||||||||||||||||||||||||||||||| | ||||||| u
3'   acaaaccuauguucgguauucgagaaaacucucgaagagaug c uuuauaua 
   ag                                          g c         
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr3: 45034824-45034934 [+]
intergenic
Database links

Mature sequence gma-miR1516a-5p

Accession MIMAT0020937
Previous IDsgma-miR1516*
Sequence

13 - 

caaguuauaagcucuuuugagag

 - 35

Get sequence
Evidence experimental; SOLiD [2]

Mature sequence gma-miR1516a-3p

Accession MIMAT0007375
Previous IDsgma-miR1516
Sequence

81 - 

caaaagagcuuauggcuugua

 - 101

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:18402695 "Novel and nodulation-regulated microRNAs in soybean roots" Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O BMC Genomics. 9:160(2008).
2