Stem-loop sequence gma-MIR1517

AccessionMI0007230 (change log)
DescriptionGlycine max miR1517 stem-loop
Literature search

2 open access papers mention gma-MIR1517
(3 sentences)

Stem-loop
         -ua       c       a   -au                 auugacuaaguuuuuacagucgacauccacuagaguuuuuucgaucgacaucggucaaagcaauuuuuuagccaacaucaaucaaggcuauuuuauagccgauguuggguaggguuuuuuauucgacaucagucagggcuauuuuuuagcc 
5' gcuagg   uuuuuga cgacauu gac   gacuauuuuuagucgac                                                                                                                                                       a
   ||||||   ||||||| ||||||| |||   |||||||||||||||||                                                                                                                                                        
3' ugaucc   aaaagcu gcuguaa cug   cugauaaaaaucgguug                                                                                                                                                       a
         caa       u       -   guu                 caguuggauuuuuuaggaucguccgcaacuguuuuuuuagauagaucauagcugauuuuuuaucgaaccagcuacggcugguuaucuuggaugggcuacagcugacuuuuuguaguaaucaguuacaaccgacuuuuuagagaucagcuuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr14: 43676665-43677061 [+]
intergenic
Database links

Mature sequence gma-miR1517

Accession MIMAT0007376
Sequence

364 - 

agucuuggucaaugucguucgaaa

 - 387

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:18402695 "Novel and nodulation-regulated microRNAs in soybean roots" Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O BMC Genomics. 9:160(2008).