Stem-loop sequence gma-MIR1518

AccessionMI0007231 (change log)
DescriptionGlycine max miR1518 stem-loop
Literature search

2 open access papers mention gma-MIR1518
(2 sentences)

Stem-loop
   augug     -    -    aaa          uc   acauaggucaugagaucaacauugacagauuua 
5'      caaaa ugug uugu   gugaauauca  ggc                                 c
        ||||| |||| ||||   ||||||||||  |||                                 a
3'      guuuu acac aaca   cacuuauagu  ccg                                 g
   -uaag     c    u    --c          --   auuuguaaauagcacaagagugcaguuccgacg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr9: 7525122-7525259 [+]
intergenic
Database links

Mature sequence gma-miR1518

Accession MIMAT0007377
Sequence

11 - 

uguguuguaaagugaauauca

 - 31

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:18402695 "Novel and nodulation-regulated microRNAs in soybean roots" Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O BMC Genomics. 9:160(2008).