Stem-loop sequence gma-MIR1520d

AccessionMI0007233 (change log)
DescriptionGlycine max miR1520d stem-loop
Gene family MIPF0000581; MIR1520
Literature search

10 open access papers mention gma-MIR1520d
(17 sentences)

Stem-loop
   ---       c a    a                 auguuaac  u       -     a 
5'    augauga u ucac ugucauguucugauugg        uc augaaaa aacaa u
      ||||||| | |||| |||||||||||||||||        || ||||||| ||||| a
3'    uacuauu a agug acaguacaagacuaacu        ag uacuuuu uuguu c
   acc       a c    c                 --------  u       g     a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr7: 124349-124459 [-]
intergenic
Database links

Mature sequence gma-miR1520d

Accession MIMAT0007379
Sequence

80 - 

aucagaacaugacacgugacaa

 - 101

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:18402695 "Novel and nodulation-regulated microRNAs in soybean roots" Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O BMC Genomics. 9:160(2008).