Stem-loop sequence gma-MIR1536

AccessionMI0007234 (change log)
DescriptionGlycine max miR1536 stem-loop
Gene family MIPF0001624; MIR1536
Literature search

2 open access papers mention gma-MIR1536
(3 sentences)

Stem-loop
   -------------------------gagaggauagcaauauugucucugcuuuaauuuaucaccacauuccuucucaucucaagagaugcuuugcuuauugu     au  c   g   u   cauau    gu 
5'                                                                                                       gccau  uc caa aga uua     guuu  a
                                                                                                         |||||  || ||| ||| |||     ||||   
3'                                                                                                       cggua  ag guu uuu aau     cgag  a
   guacguacugauuuguguaaacagagacgaacuaacaaauuguuguauggguguauuauauaguagauuuaugagaguacucccguaacauauuuuaaaagu     --  u   g   u   --uuu    ag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr15: 44547119-44547359 [-]
intergenic
Database links

Mature sequence gma-miR1536

Accession MIMAT0007380
Sequence

211 - 

aagcagagacaaauguguuua

 - 231

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:18402695 "Novel and nodulation-regulated microRNAs in soybean roots" Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O BMC Genomics. 9:160(2008).