Stem-loop sequence gma-MIR1521a

AccessionMI0007236 (change log)
Previous IDsgma-MIR1521
DescriptionGlycine max miR1521 stem-loop
Gene family MIPF0001062; MIR1521
Literature search

2 open access papers mention gma-MIR1521a
(2 sentences)

Stem-loop
   ---------------------------------------------------uacuca              aa           c  a           c          u  -aa   u 
5'                                                          uugacuguuaaugg  aauguugacug ca augucauaauc uauuggaugu aa   uug a
                                                            ||||||||||||||  ||||||||||| || ||||||||||| |||||||||| ||   |||  
3'                                                          aacugacaauuacc  uugcaauugac gu uacaguauuag auaaccugca uu   agc u
   cuuguaauuaacaauaacuuauuacaacugacaauacacaguguuaaaauaaccugc              ca           a  a           u          c  aaa   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr11: 12131319-12131508 [-]
intergenic
Clustered miRNAs
< 10kb from gma-MIR1521a
gma-MIR1521bchr11: 12131454-12131604 [+]
gma-MIR1521achr11: 12131319-12131508 [-]
Database links

Mature sequence gma-miR1521a

Accession MIMAT0007382
Previous IDsgma-miR1521
Sequence

11 - 

cuguuaauggaaaauguuga

 - 30

Get sequence
Evidence experimental; 454 [1], Illumina [2]

References

1
PMID:18402695 "Novel and nodulation-regulated microRNAs in soybean roots" Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O BMC Genomics. 9:160(2008).
2