Stem-loop gma-MIR1523a

Accession

MI0007240

Description

Glycine max gma-MIR1523a precursor miRNA

Gene family

MIPF0001327; MIR1523

Literature search

1 open access papers mention gma-MIR1523a
(1 sentences)

Sequence

aggacccauuAUGGGAUAAAUGUGAGCUCAggagcgaugaauaaauccuuucaucacuccucauuacucccgagcucacauuuauuucaaaauga
......((((.(((((((((((((((((((((((.((((((........)))))).)))))..........)))))))))))))))))).)))).

Structure

aggacc    A                  ----------     c      uaa 
      cauu UGGGAUAAAUGUGAGCUC          Aggag gaugaa   a
      |||| ||||||||||||||||||          ||||| ||||||    
      guaa acuuuauuuacacucgag          uccuc cuacuu   u
-----a    a                  cccucauuac     a      ucc 

Annotation confidence Not enough data

Genome context

chr2: 12591029-12591123 [-]

Clustered miRNAs

1 other miRNA is < 10 kb from gma-MIR1523a

Mature gma-miR1523a

• Accession: MIMAT0007384
• Description: Glycine max gma-miR1523a mature miRNA
• Sequence: 11 - AUGGGAUAAAUGUGAGCUCA - 30
• Evidence: experimental ; 454 [1], Illumina [2]

References

1. PubMed ID: 18402695
   Novel and nodulation-regulated microRNAs in soybean roots
   Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O
   BMC Genomics (2008) 9:160


2. PubMed ID: 24475082
   Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons
   Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ
   PLoS One (2014) 9:e86153