Stem-loop sequence gma-MIR1520b

AccessionMI0007243 (change log)
DescriptionGlycine max miR1520b stem-loop
Gene family MIPF0000581; MIR1520
Literature search

2 open access papers mention gma-MIR1520b
(2 sentences)

Stem-loop
   c                           a                  -------    -ccaa  ac 
5'  gugucacguucuuauugaaugaugacu uuacgugucauguucuga       ucga     ug  a
    ||||||||||||||||||||||||||| ||||||||||||||||||       ||||     ||  a
3'  uacagugcaagaauaauuuacuacuga agugcacaguacaagacu       agcu     ac  c
   a                           c                  aaccuac    uaaua  aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr20: 41755528-41755656 [-]
intergenic
Database links

Mature sequence gma-miR1520b

Accession MIMAT0007387
Sequence

97 - 

gugacagucaucauuuaauaaga

 - 119

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:18402695 "Novel and nodulation-regulated microRNAs in soybean roots" Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O BMC Genomics. 9:160(2008).