Stem-loop sequence gma-MIR1527

AccessionMI0007245 (change log)
DescriptionGlycine max miR1527 stem-loop
Literature search

1 open access papers mention gma-MIR1527
(1 sentences)

Stem-loop
                                  a      auuucaacaugguaucagagccauugaaccacaugcuaucagguuuccgcuaucgggccaccccccauuuaugucuacgaa 
5' cucacaagccgguuuuguaagguugaguuag ccucaa                                                                                 c
   ||||||||||||||||||||||||||||||| ||||||                                                                                 c
3' gaguguucggccaaaacauuccaacucaauc ggaguu                                                                                 a
                                  c      gaaauauuuauauaacagucugguacaggauaggcuacacccugagaauugugugggggagugcuagucgugauaauccaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence gma-miR1527

Accession MIMAT0007389
Sequence

212 - 

uaacucaaccuuacaaaacc

 - 231

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:18402695 "Novel and nodulation-regulated microRNAs in soybean roots" Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O BMC Genomics. 9:160(2008).