Stem-loop sequence gma-MIR1528

AccessionMI0007246 (change log)
DescriptionGlycine max miR1528 stem-loop
Literature search

1 open access papers mention gma-MIR1528
(1 sentences)

Stem-loop
   ugauuguugaauagauuagaucaauauauuaguaaguuuuuauuagaccaagaugagagucaguuuuua          c   c      c           c      ga c          guuauguuuguaacuauuaaaa 
5'                                                                      uuggauuaau ugu auaucu aaauuuuauuu auuuaa  a aaaauauaau                      a
                                                                        |||||||||| ||| |||||| ||||||||||| ||||||  | ||||||||||                       
3'                                                                      aaccugauua aca uauggg uuuaaaauaaa uaaauu  u uuuuauauua                      a
   ---------------------------accaaccacuuaucuaaucuaguuuuauaguuauucaaagau          a   a      u           a      uc a          aauuaaaaguagaagaggaacu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr8: 4502473-4502737 [-]
intergenic
Database links

Mature sequence gma-miR1528

Accession MIMAT0007390
Sequence

11 - 

auagauuagaucaauauauuagu

 - 33

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:18402695 "Novel and nodulation-regulated microRNAs in soybean roots" Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O BMC Genomics. 9:160(2008).