Stem-loop sequence gma-MIR1530

AccessionMI0007249 (change log)
DescriptionGlycine max miR1530 stem-loop
Literature search

2 open access papers mention gma-MIR1530
(9 sentences)

Stem-loop
   gca       auauua    -aagu              auuuaauuuuuuuuaauuuauuauauuuuuauaauuuu 
5'    aaauaua      auau     uuuaugugaaaaua                                      a
      |||||||      ||||     ||||||||||||||                                       
3'    uuuguau      uaua     aaauacacuuuuau                                      u
   -ua       -----g    aaauu              cuuaaauuagaauauauaauauaaaauuuucuauuaua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr10: 41788173-41788321 [+]
intergenic
Database links

Mature sequence gma-miR1530

Accession MIMAT0007392
Sequence

119 - 

uuuucacauaaauuaaaauau

 - 139

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:18402695 "Novel and nodulation-regulated microRNAs in soybean roots" Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O BMC Genomics. 9:160(2008).