Stem-loop sequence gma-MIR1535a

AccessionMI0007257 (change log)
Previous IDsgma-MIR1535
DescriptionGlycine max miR1535 stem-loop
Literature search

1 open access papers mention gma-MIR1535a
(1 sentences)

Stem-loop
   uaa    c                     -     aaagaa   agagug 
5'    gagg cuagacaucaccacaaacaag ucacc      gga      u
      |||| ||||||||||||||||||||| |||||      |||       
3'    uucc gaucuguagugguguuuguuc agugg      ccu      c
   ucc    a                     u     -----g   aagaca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr19: 43989978-43990073 [+]
intergenic
Clustered miRNAs
< 10kb from gma-MIR1535a
gma-MIR1535bchr19: 43989927-43990016 [-]
gma-MIR1535achr19: 43989978-43990073 [+]
gma-MIR160cchr19: 43999110-43999200 [-]
Database links

Mature sequence gma-miR1535a

Accession MIMAT0007398
Previous IDsgma-miR1535
Sequence

68 - 

cuuguuuguggugaugucu

 - 86

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:18402695 "Novel and nodulation-regulated microRNAs in soybean roots" Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O BMC Genomics. 9:160(2008).