Stem-loop sequence gga-mir-1c

AccessionMI0007361 (change log)
DescriptionGallus gallus miR-1c stem-loop
Literature search

23 open access papers mention gga-mir-1c
(155 sentences)

Stem-loop 
         g   cug      a  -    u  g      a 
5' ggcuca ugg   gaaugg aa gcag au uauuuu u
   |||||| |||   |||||| || |||| || ||||||  
3' ucgagu acu   uuuauu uu cguu ua auaaaa g
         -   -ua      a  a    -  g      u
Get sequence
Deep sequencing
2023 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr7: 35184305-35184378 [+]
intergenic
Database links

Mature sequence gga-miR-1c

Accession MIMAT0007503
Sequence

12 -  

uggaauggaaagcaguauguau

 - 33

Get sequence
Deep sequencing2023 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).