Stem-loop sequence mml-let-7d

AccessionMI0007575 (change log)
DescriptionMacaca mulatta let-7d stem-loop
Gene family MIPF0000002; let-7
Literature search

4 open access papers mention mml-let-7d
(7 sentences)

Stem-loop
          a              c      uuagggcagggauu 
5' ccuagga gagguaguagguug auaguu              u
   ||||||| |||||||||||||| ||||||               
3' ggauucu uuccgucguccagc uaucaa              u
          -              a      uggaggaacacccg 
Get sequence
Deep sequencing
479229 reads, 2.54e+03 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr15: 44325586-44325672 [+]
intergenic
Clustered miRNAs
< 10kb from mml-let-7d
mml-let-7a-1chr15: 44322723-44322802 [+]
mml-let-7f-1chr15: 44323112-44323198 [+]
mml-let-7dchr15: 44325586-44325672 [+]
Database links

Mature sequence mml-let-7d

Accession MIMAT0006154
Sequence

8 - 

agagguaguagguugcauaguu

 - 29

Get sequence
Deep sequencing476886 reads, 9 experiments
Evidence by similarity; MI0000065
Database links
Predicted targets

References

1