Stem-loop sequence mml-mir-20b

AccessionMI0007591 (change log)
DescriptionMacaca mulatta miR-20b stem-loop
Gene family MIPF0000001; mir-17
Literature search

2 open access papers mention mml-mir-20b
(5 sentences)

Stem-loop
        -ca           g     -gu    uu 
5' aguac   aagugcucaua ugcag   aguu  g
   |||||   ||||||||||| |||||   ||||  g
3' ucaug   uucacgggugu auguc   ucag  c
        acc           g     auc    ua 
Get sequence
Deep sequencing
5618 reads, 22.2 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chrX: 128132164-128132232 [-]
intergenic
JSUE03164174.1: 197-265 [-]
intergenic
Clustered miRNAs
< 10kb from mml-mir-20b
mml-mir-106achrX: 128132553-128132633 [-]
mml-mir-18bchrX: 128132396-128132466 [-]
mml-mir-20bchrX: 128132164-128132232 [-]
mml-mir-19b-2chrX: 128132026-128132121 [-]
mml-mir-92a-2chrX: 128131893-128131967 [-]
mml-mir-363chrX: 128131733-128131807 [-]
Database links

Mature sequence mml-miR-20b-5p

Accession MIMAT0006164
Sequence

6 - 

caaagugcucauagugcagguag

 - 28

Get sequence
Deep sequencing5608 reads, 9 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-20b-3p

Accession MIMAT0026799
Sequence

43 - 

uacuguagugugggcacuuccag

 - 65

Get sequence
Deep sequencing10 reads, 4 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).