Stem-loop sequence mml-mir-422a

AccessionMI0007738 (change log)
DescriptionMacaca mulatta miR-422a stem-loop
Gene family MIPF0000548; mir-422
Literature search

1 open access papers mention mml-mir-422a
(1 sentences)

Stem-loop
   -----   a  ---a  ac   a       u  g a     ga    c c 
5'      gag ga    gc  ugg cucaggg ca a ggccu  gucu c u
        ||| ||    ||  ||| ||||||| || | |||||  |||| | g
3'      cuc cu    cg  acc gaguccc gu u ucggg  uaga g c
   ggucc   -  guuc  -a   -       u  g g     --    c u 
Get sequence
Deep sequencing
19 reads, 0 reads per million, 6 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr7: 40461056-40461145 [-]
antisense
ENSMMUT00000040454 ; USP3-203; intron 1
ENSMMUT00000016959 ; USP3-201; intron 2
ENSMMUT00000040455 ; USP3-202; intron 3
Database links

Mature sequence mml-miR-422a

Accession MIMAT0006320
Sequence

10 - 

acuggacucagggucagaaggc

 - 31

Get sequence
Deep sequencing19 reads, 6 experiments
Evidence by similarity; MI0001444
Predicted targets

References

1