Stem-loop sequence vvi-MIR399c

AccessionMI0007960 (change log)
DescriptionVitis vinifera miR399c stem-loop
Gene family MIPF0000015; MIR399
Literature search

5 open access papers mention vvi-MIR399c
(12 sentences)

Stem-loop
   --     u u      cu     ac         g --   a 
5'   accgg c cagggc  cuuuc  uugguaggu a  cau g
     ||||| | ||||||  |||||  ||||||||| |  |||  
3'   ugguc g gucccg  gagag  aaccgucua u  gug a
   au     u u      uu     ga         g aa   u 
Get sequence
Deep sequencing
318 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr15: 15232200-15232281 [+]
intergenic
Database links

Mature sequence vvi-miR399c

Accession MIMAT0006565
Sequence

52 - 

ugccaaaggagaguugcccug

 - 72

Get sequence
Deep sequencing318 reads, 2 experiments
Evidence experimental; Array [2]

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).
2
PMID:19939267 "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera" Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS BMC Genomics. 10:558(2009).